rs578111 chr3:183116069 A>G
- Sequence
caaaacccctaggaaaccctcaga[A/G]gcctccaattggccacaccccatg
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.29 | -1.23 | 4.00 |
Items per page:
1 – 1 of 1