rs579477 chr6:125814747 C>G
- Sequence
agggtttaaagccatgctgaggaa[C/G]agcttcctgtgtctttgtactttc
- ASB in cell types
- periferal blood macrophages monocyte-derived macrophages GM12878 (female B-cells)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.41 | -0.27 | 1.98 | n/a | No Hit |
Items per page:
1 – 1 of 1