rs57963400 chr11:69900782 G>A
- Sequence
tcttggccaaactacaaggaaact[G/A]cttccccacggctggtgtccctat
- ASB in cell types
- liver HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.74 | 0.16 | 1.33 | |||
| HT29 (colon adenocarcinoma) | 1.74 | -0.58 | 3.00 |
Items per page:
1 – 2 of 2