rs581244 chr1:94068434 A>T
- Sequence
attctcatggggaagccacctgcc[A/T]tgcagcaagtgacctcattcccta
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.21 | 0.87 | 1.99 | |||
| HepG2 (hepatoblastoma) | 0.30 | 0.57 | 1.36 | |||
| HT29 (colon adenocarcinoma) | -0.23 | 1.30 | 2.00 |
Items per page:
1 – 3 of 3