rs58199981 chr3:14216316 T>G
- Sequence
ttctcagtcagatgctcccctcgt[T/G]cccctcgtggtgacaggatggcgc
- ASB in cell types
- SK-N-SH (neuroblastoma) pancreas adrenal gland stomach
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 2.17 | -2.42 | 1.33 | |||
| pancreas | -1.49 | 1.66 | 1.00 | |||
| adrenal gland | -1.59 | 1.81 | 1.00 | |||
| stomach | -1.86 | 1.89 | 1.00 |
Items per page:
1 – 4 of 4