rs583138 chr4:81844893 G>A
- Sequence
tagcgacatttagtggtggtgccc[G/A]caaattacaactaggtgtcccaaa
- ASB in cell types
- liver HeLa S3 (cervical adenocarcinoma) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.94 | -1.51 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | 1.15 | -0.48 | 1.33 | |||
| IPSC-derived bipolar neuron | 0.51 | -0.41 | 1.00 |
Items per page:
1 – 3 of 3