rs583821 chr1:110312817 A>G
- Sequence
gcttgccagggcaggcaatcccac[A/G]ctgtgtccgctgtgggaattgact
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HepG2 (hepatoblastoma) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.83 | -0.13 | 1.98 | |||
| K562 (myelogenous leukemia) | 0.56 | 0.47 | 1.34 | |||
| HepG2 (hepatoblastoma) | 0.60 | 0.36 | 1.34 | |||
| neutrophils | -0.43 | 1.68 | 1.67 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid