rs584390 chr7:71736227 G>T
- Sequence
tgtggaattcaggggcaaggacac[G/T]gttgacctagactcagcttgactg
- ASB in cell types
- fibroblast of dermis A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fibroblast of dermis | 1.79 | n/a | 2.00 | |||
| A549 (lung carcinoma) | 0.01 | 0.48 | 2.00 |
Items per page:
1 – 2 of 2