rs586108 chr1:54856563 T>C
- Sequence
ttgcagtgagccaagattgcacca[T/C]tgcactccagcctggatgactcag
- ASB in cell types
- liver MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.74 | 0.01 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.95 | 1.73 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood