rs587259 chr19:34165501 C>T
- Sequence
acttcctctttcaatccaaggcca[C/T]gctcctcccagacaaccccagcca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.97 | -0.24 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic inflammatory diseases (ankylosing spondylitis, crohns disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy)
GRASP birth weight, comorbid depressive syndrome and alcohol dependence, irritible bowel syndrome, late onset alzheimers disease, obesity with early age of onset (age >2), schizophrenia