rs587274 chr18:63994976 C>A
- Sequence
agcagggaggcaaagatgactatc[C/A]ggcgccctctactggacgatctag
- ASB in cell types
- foreskin keratinocyte H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.46 | n/a | 2.50 | |||
| H1 (embryonic stem cells) | 1.03 | -0.23 | 1.38 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, paternal transmission distortion, transmission distortion, years of education