rs588245 chr2:21047185 A>G
- Sequence
aattagcctatctcgtttctgcct[A/G]tgacagcattataattgcaaatga
- ASB in cell types
- HepG2 (hepatoblastoma) VCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN SOX13_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.06 | 0.87 | 1.73 | n/a | No Hit | |||
| SOX13_HUMAN | n/a | 1.92 | 2.00 | n/a | n/a | |||
| MNT_HUMAN | -0.88 | 1.61 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP college completion, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, parkinsons disease, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid