rs590352 chr12:74538379 G>C
- Sequence
tgggaatgggcctgatcagcagct[G/C]cagcgctcacctccggaattccag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.81 | -0.23 | 2.02 | |||
| HEK293 (embryonic kidney) | 0.68 | -0.13 | 1.98 | |||
| HEK293T (embryonic kidney) | -0.14 | 1.43 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg