rs592069 chr9:107989453 G>A
- Sequence
ttattcctccccctgctttcctgc[G/A]cttccctattcatcctttaaaacc
- ASB in cell types
- periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.58 | 1.65 | 2.17 | 2.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adult asthma, college completion, microalbuminuria, mitral annular calcium, schizophrenia, sporadic creutzfeldt-jakob disease, total cholesterol, triglycerides change with statins