rs592083 chr1:41841093 A>C
- Sequence
gtgcagttaatgactgtagcctgg[A/C]gggccgtgcagacaacaacaaagc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.29 | 0.74 | 1.98 |
Items per page:
1 – 1 of 1