rs592373 chr11:1869760 G>A
- Sequence
gctggcgagcttgccaaggagagg[G/A]cgggcgaggaaaatggggcgcccc
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.59 | 0.07 | 1.42 | -2.43 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), irritible bowel syndrome, mean arterial pressure, parkinsons disease, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood