rs592694 chr1:209836188 G>T
- Sequence
tcactcagcatgattccctggaga[G/T]tcatccaagttatttcagctatca
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.93 | -1.58 | 1.33 | -2.97 | Concordant | |||
| JUND_HUMAN | 0.84 | -1.67 | 1.33 | -5.70 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Spleen, Whole_Blood