rs594132 chr1:147542066 A>C
- Sequence
ggccttgcaggctccgagctgtgc[A/C]ttctcaggctgagcaagggccggc
- ASB in cell types
- HEK293 (embryonic kidney) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.90 | -0.08 | 2.03 | |||
| T47D (invasive ductal carcinoma) | 1.14 | -0.81 | 2.00 |
Items per page:
1 – 2 of 2