rs594626 chr1:109154605 A>C
- Sequence
ggccccatttgaggggctttccag[A/C]cagtctgggccatccgttgcagtc
- ASB in cell types
- breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 2.27 | n/a | 2.50 |
Items per page:
1 – 1 of 1