rs595292 chr20:58245646 G>T
- Sequence
ctgaacaagtctctcctctcaatg[G/T]gtatacagtgtaaatgaatacagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.66 | 0.96 | 3.60 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, oral cancer in patients with long term tobacco chewing habit, premature ovarian failure, serum creatinine, spine bone mineral density (bmd), systolic blood pressure (sbp)