rs595606 chr1:210344127 A>G
- Sequence
ccagaatgtatcactgtgctgtca[A/G]gtggagactatttggttcaattcc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.21 | 0.41 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Esophagus_Mucosa, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid