rs596342 chr5:135133495 T>C
- Sequence
ggcagggagggggtgatgccaatt[T/C]agaacgtgggagaagatcacatgc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | -0.52 | 1.77 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, imprinting effects on cleft lip, resistance to kuru in aged women despite likely exposure, tetrology of fallot, total cholesterol change with statins, triglycerides change with statins