rs596631 chr8:103000436 G>A
- Sequence
aaaagacaagcaataccaccagac[G/A]atagatgtaatttggaacaaagat
- ASB in cell types
- monocyte-derived macrophages monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | -3.21 | 1.98 | 2.50 | |||
| monocyte-derived dendritic cells | 2.14 | -3.10 | 2.00 |
Items per page:
1 – 2 of 2