rs59962067 chr1:235636528 A>G
- Sequence
ctgcagcaagccacggccacgcag[A/G]ggcacggtgcccacgctgagacct
- ASB in cell types
- epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.28 | 1.11 | 1.80 | 2.53 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cortex, Breast_Mammary_Tissue, Colon_Transverse, Nerve_Tibial, Small_Intestine_Terminal_Ileum