rs6001931 chr22:40481510 G>A
- Sequence
gaaaacataataaataaggtgtac[G/A]tattataatttcagggagtacatt
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.54 | 1.53 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast size (bra cup size in women), college completion, comorbid depressive syndrome and alcohol dependence, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Artery_Aorta, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Testis, Thyroid