rs600524 chr2:67446648 G>A
- Sequence
ttttcctctataattaatttcctt[G/A]agtcactgaatacctttatctacc
- ASB in cell types
- HEK293 (embryonic kidney) VCaP (prostate carcinoma)
- ASB for transcription factors
- SP7_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP7_HUMAN | 2.38 | -2.62 | 1.33 | n/a | n/a | |||
| ANDR_HUMAN | 0.69 | 0.45 | 1.97 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), chronic kidney disease, cystatin c in serum, hip bone mineral density (bmd), homa-b, infant head circumference, longstanding arthritis, obesity (body mass index (bmi)), spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, years of education