rs60089918 chr17:3913884 C>T
- Sequence
tggggggggtggtcccctgcaacc[C/T]gtgccccacgggccggttaggaag
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.61 | n/a | 2.67 | |||
| HEK293 (embryonic kidney) | 0.52 | 0.60 | 1.70 |
Items per page:
1 – 2 of 2