rs6013018 chr20:50794549 A>G
- Sequence
ccaagccccactccgaaggattcc[A/G]acttaatcggcctggtgcgaggcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) GM12878 (female B-cells) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 2.05 | 4.00 | |||
| HEK293 (embryonic kidney) | 0.84 | -0.17 | 2.05 | |||
| GM12878 (female B-cells) | 0.36 | 0.67 | 2.00 | |||
| HEK293T (embryonic kidney) | -0.66 | 1.11 | 2.00 |
Items per page:
1 – 4 of 4