rs60130327 chr1:42961782 C>T
- Sequence
agattcatgatggagccccagatc[C/T]ggactctttgagtcccagctctgc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 0.98 | -0.09 | 1.50 |
Items per page:
1 – 1 of 1