rs602209 chr20:10093145 G>T
- Sequence
acaattagccaagaggcaaagtca[G/T]gattaagcatcctgactcactcta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -1.35 | 1.72 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, hypertension (early onset hypertension), microalbuminuria, resistance to kuru in aged women despite likely exposure, schizophrenia, urinary albumin-to-creatinine ratio, years of education