rs6023012 chr20:54190034 A>G
- Sequence
ctggttgtcaaaatccttatttaa[A/G]tctttaaggagaaaagcaatggtt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.91 | 1.18 | 5.20 | |||
| HepG2 (hepatoblastoma) | -0.67 | 0.87 | 1.20 |
Items per page:
1 – 2 of 2