rs602716 chr11:118930526 G>A
- Sequence
acactggcgacgacagtagagtgt[G/A]cctcttgcgggaacagcaccttcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) foreskin keratinocyte epidermal keratinocytes
- ASB for transcription factors
- CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CLOCK_HUMAN | -0.74 | 1.58 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, obesity with early age of onset (age >2), prop taste detection threshold, salmonella-induced pyroptosis, tourettes syndrome
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood