rs60290390 chr7:42097936 T>C
- Sequence
tgtgcctagcccatttctgagaac[T/C]tactggccttattcaaatcccatg
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.60 | -0.31 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.13 | 0.82 | 2.20 |
Items per page:
1 – 2 of 2