rs60324752 chr8:11629141 T>C
- Sequence
ctgcgcaggcccaggtggaggtac[T/C]tcaggaaagccggccaggcggact
- ASB in cell types
- HepG2 (hepatoblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.61 | 0.35 | 1.31 | |||
| liver | 0.95 | -0.01 | 1.33 |
Items per page:
1 – 2 of 2