rs605025 chr1:155917981 T>C
- Sequence
agaactccaaccactgacagtcga[T/C]gtgattagctttctgtaataagct
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.53 | -0.22 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, abnormal involuntary movement scale, advanced age-related macular degeneration, biploar disorder (bipolar schizoaffective disorder), birth weight, ldl cholesterol, ldl cholesterol change with statins, simpson-angus scale, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid, Whole_Blood