rs6062340 chr20:64051922 T>C
- Sequence
ttgccagggctgtagaggggatgg[T/C]gtgggtgtggccagctgtgctgag
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.78 | -0.18 | 2.05 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), schizophrenia
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood