rs606458 chr11:64778919 C>T
- Sequence
tcgcgggattggctgtcgctggtt[C/T]cagcctttttctactcccctcccc
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 0.11 | 2.30 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, height, neuroblastoma (brain cancer), serum urate, uric acid, variant creutzfeldt-jakob disease, waist hip ratio
PheWAS abnormality of gait, acquired deformities of finger, acquired hypothyroidism, alopecia, alopecia areata, arthropathy nos involving multiple sites, biliary cirrhosis, bipolar, breast conditions, congenital or relating to hormones, cancer of brain and nervous system, central/nonobstroctive sleep apnea, cerebrovascular disease, cholelithiasis with other cholecystitis, chronic interstitial cystitis, chronic obstructive asthma with exacerbation, congenital anomalies of urinary system, cornea replaced by transplant, cramp of limb, cystic kidney disease, cysts of the jaws, decubitus ulcer, deep vein thrombosis, degenerative disease of the spinal cord, diseases of hair and hair follicles, diseases of sebaceous glands, disorders of coccyx, disorders of penis, ectropion or entropion, gangrene, gastroparesis, genitourinary congenital anomalies, gram positive septicemia, history of diseases of digestive system, hypertrophy of breast (gynecomastia), hypocalcemia, infections involving bone, intracerebral hemorrhage, intracranial hemorrhage, leukemia, loose body in joint, lower gastrointestinal congenital anomalies, malignant neoplasm of brain and nervous system, melanoma, memory loss, multiple myeloma, myalgia and myositis nos, non-healing surgical wound, non-melanoma skin cancer, noninflammatory disorders of cervix, noninflammatory disorders of vulva and perineum, noninflammatory female genital disorders, nonspecific findings on examination of blood, open wound of finger(s), open wound of hand except finger(s), open wounds of extremities, osteoarthrosis, osteoarthrosis nos, osteomyelitis, other cerebral degenerations, other rheumatic heart disease, other specified intestinal malabsorption, other specified osteoporosis, pain in joint, peptic ulcers, pneumonitis due to inhalation of food or vomitus, poisoning by water, mineral, and uric acid metabolism drugs, postmenopausal atrophic vaginitis, posttraumatic stress disorder, retinal detachment with retinal defect, scar conditions and fibrosis of skin, sciatica, sebaceous cyst, sicca syndrome, spontaneous ecchymoses, sprains and strains, stomatitis and mucositis, stress incontinence, female, subjective visual disturbances, swelling, mass, or lump in head and neck, symptoms involving head and neck, thyroiditis, transient cerebral ischemia, trigeminal nerve disorders, unspecified osteomyelitis, vascular disorders of kidney/hypertrophy
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Colon_Sigmoid, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis, Thyroid, Whole_Blood