rs6072373 chr20:41443905 T>C
- Sequence
tttcttccaagtcctgatccacct[T/C]ggttttctgtatgtctatggtggg
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.90 | -2.08 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, birth weight, college completion, diastolic blood pressure (dbp), salmonella-induced pyroptosis, stabilized warfarin dose, systolic blood pressure (sbp), tetrology of fallot, years of education
GTEx eQTL Brain_Amygdala, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Thyroid