rs607284 chr6:139941229 A>G
- Sequence
ggaagtgagcaataatttacatac[A/G]tttatagagtagtgccctcttatc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.09 | 0.68 | 1.33 | |||
| GM12878 (female B-cells) | 0.01 | 0.60 | 1.35 | |||
| periferal blood macrophages | 1.09 | 0.35 | 2.00 |
Items per page:
1 – 3 of 3