rs607428 chr10:83817067 G>A
- Sequence
ggcaggactgacctagcaatttct[G/A]tagcctgacatagtctcactgagg
- ASB in cell types
- breast tumor tissue GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.43 | -1.26 | 1.33 | n/a | n/a | |||
| ESR1_HUMAN | -1.16 | 2.08 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, barnes akathisia rating scale, neuroticism, simpson-angus scale, sporadic amyotrophic lateral sclerosis (als) age of onset, total cholesterol