rs6080917 chr20:17961094 C>T
- Sequence
ttggtaagagagccaaggcacttc[C/T]ctaaaaggagaaaagtagttacgg
- ASB in cell types
- monocyte-derived dendritic cells CD34+ hematopoietic stem progenitor cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 2.60 | 2.50 | |||
| CD34+ hematopoietic stem progenitor cells | 1.94 | n/a | 1.33 | |||
| HepG2 (hepatoblastoma) | 0.53 | 0.37 | 1.27 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood