rs608444 chr11:119115920 G>A
- Sequence
ctgctttctttcctgaggaagcct[G/A]gcttctgggccacgggactgatcc
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN NRF1_HUMAN MGAP_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.98 | -1.88 | 2.25 | n/a | No Hit | |||
| NRF1_HUMAN | -3.65 | 2.43 | 2.00 | n/a | No Hit | |||
| MGAP_HUMAN | -3.41 | 2.42 | 2.00 | n/a | n/a | |||
| LMBL2_HUMAN | n/a | 2.07 | 2.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood