rs6086563 chr20:8722498 C>G
- Sequence
ctgggtctgtctcatggtcacttt[C/G]tgccatctagtggcaaaaagtaga
- ASB in cell types
- foreskin keratinocyte HepG2 (hepatoblastoma) right atrium auricular region
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.56 | 2.17 | |||
| HepG2 (hepatoblastoma) | 0.46 | 0.45 | 1.28 | |||
| right atrium auricular region | 1.76 | -1.69 | 1.00 |
Items per page:
1 – 3 of 3