rs6089695 chr20:62232970 C>T
- Sequence
ctgctcctgaggagaaacccatgg[C/T]gccaccctcaggcccccggtggct
- ASB in cell types
- T47D (invasive ductal carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 2.06 | n/a | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.35 | 0.77 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Testis, Whole_Blood