rs609438 chr6:137702105 C>A
- Sequence
ctgccctgttagaacagggccaca[C/A]cattgctggggtttggcacacaaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.15 | 0.94 | 1.38 |
Items per page:
1 – 1 of 1