rs610722 chr5:4912197 A>G
- Sequence
agcatgaggtcacaatcccccgct[A/G]tcagttacagatgctgaagatccg
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | -2.17 | 1.94 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol change with statins, hypertension (early onset hypertension)