rs611060 chr1:109239568 C>T
- Sequence
tacagctgcctgcaccactcccca[C/T]gcctacctgcttaggctcctggtg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.50 | 0.55 | 1.34 | |||
| foreskin keratinocyte | 0.72 | n/a | 2.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, bipolar disorder, body mass index (bmi), college completion, coronary artery disease (cad), hdl cholesterol, height, late onset alzheimers disease, ldl cholesterol, obesity (body mass index (bmi)), resistance to kuru in aged women despite likely exposure, total cholesterol