rs61173401 chr10:69392807 C>T
- Sequence
caagcccccaggaatcaggccatc[C/T]tctgccacggccaggatgagttgg
- ASB in cell types
- foreskin keratinocyte neutrophils breast tumor tissue CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.30 | n/a | 2.67 | |||
| neutrophils | 1.31 | -0.68 | 1.92 | |||
| breast tumor tissue | 1.79 | -0.32 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.86 | -3.78 | 2.50 |
Items per page:
1 – 4 of 4