rs611917 chr1:109272630 A>G
- Sequence
ggctgacccctccagcatggtctc[A/G]tcttcctagggaggagtccgcact
- ASB in cell types
- PC3 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC3 (prostate carcinoma) | 1.81 | -2.38 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), apob (apolipoprotein b), college completion, coronary artery disease (cad), hdl cholesterol, height, hip bone mineral density (bmd), ldl cholesterol, ldl cholesterol change with statins, ldl cholesterol in serum, lp-pla2 activity, neuroblastoma (brain cancer), plasma progranulin levels, rheumatoid arthritis, serum creatinine, spine bone mineral density (bmd), total cholesterol, total cholesterol change with statins
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Liver, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood