rs612422 chr1:101131673 G>A
- Sequence
ggaatcattacattctatctttct[G/A]ctcttagtatttctaccccacctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KDM1A_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | -1.16 | 1.14 | 1.33 | n/a | n/a | |||
| HDAC2_HUMAN | -1.25 | 1.42 | 1.67 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hepatitis c virus (hcv)-induced liver fibrosis, late onset alzheimers disease, stabilized warfarin dose, total cholesterol
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid